Přihlásit se

Patenty a užitné vzory


Patenty:

Primery pro detekci Cochliobolus sativus v obilovinách

Vynález se týká nových primerů pro detekci houbového patogena Cochliobolus sativus v obilovinách, zejména v ječmeni a pšenici,
což má význam v rostlinolékařství a molekulární biologii.

Anotace:

Primery pro detekci Cochliobolus sativus, zejména v obilovinách, metodou PCR o složení
COSA-F (SEQ id:1) TCAAGCTGACCAAATCACCTTC
COSA-r (SEQ id:2) CTTCTCACCAGCATCTGAATATATGA,
které umožní amplifikaci fragmentu patogena o velikosti 570 bp. Využití primerů je jednak v rostlinolékařství při včasné diagnostice patogena, což umožní cílenou volbu účinné ochrany a jednak ve šlechtitelských procesech při hodnocení genových zdrojů při selekci. 

Uděleno: 3.12.2009

Číslo dokumentu: CZ 301320 B6

Majitel patentu: Agrotest Fyto, s.r.o., Kroměříž, CZ

Původce: Mgr. Pavel Matušinský, PhD., Ing. Renata Mikolášová, PhD., Ing. Karel Klem, PhD., RNDr. Tomáš Spitzer PhD.,
Dr. Ing. Ludvík Tvarůžek

Zástupce: Ministerstvo Zemědělství ČR, Těšnov 17, Praha 1


Užitné vzory:

Obilná směs pro tepelnou úpravu

Řešení se týká složení obilné směsi pro tepelnou úpravu. Tato směs je složena z celých zrn ze specifických druhů a odrůd obilnin, které jsou určeny k využití po uvaření pro přípravu příloh, přídavků do mléčných výrobků, ovocných a zeleninových salátů s benefity pro lidské zdraví, protože má zvýšený obsah ß-glukanů a anthokyanů.

Zapsáno: 18.9.2018

Číslo dokumentu: CZ 32079U1

Majitel: Agrotest fyto s.r.o., Kroměříž, PRO-BIO, obchodní společnost s.r.o., Staré Město

Původce: Ing. Kateřina Vaculová, CSc., Kroměříž, Ing. Petr Martinek, CSc., Kroměříž, Ing. Martin Hutař, Staré Město

Zástupce: Patentová kancelář VYNALEZY.cz, Mgr. Hana Jirkalová, Praha


Obilná směs pro tepelnou úpravu

Řešení se týká složení obilné směsi pro tepelnou úpravu. Tato směs je složena z celých zrn ze specifických druhů a odrůd obilnin, které jsou určeny k využití po uvaření pro přípravu příloh, přídavků do mléčných výrobků, ovocných a zeleninových salátů s benefity pro lidské zdraví, protože má zvýšený obsah karotenoidů a polyfenolů.

Zapsáno: 18.9.2018

Číslo dokumentu: CZ 32077U1

Majitel: Agrotest fyto s.r.o., Kroměříž

Původce: Ing. Petr Martinek, CSc., Kroměříž, Ing. Kateřina Vaculová, CSc., Kroměříž, Ing. Martin Hutař, Staré Město

Zástupce: Patentová kancelář VYNALEZY.cz, Mgr. Hana Jirkalová, Praha


Sypká směs k výrobě sladkého jemného pečiva se zvýšeným obsahem ß-glukanů ze zrna bezpluchého ječmene

Řešení se týká přípravy sypké směsi pro pekaře k výrobě sladkého jemného pečiva se zvýšeným obsahem vlákniny potravy v podobě ß-glukanů, dodané do směsi využitím produktů získaných zpracováním odrůdy bezpluchého ječmene jarního, registrovaného v ČR pro potravinářské využití.

Zapsáno: 11.9.2018

Číslo dokumentu: CZ 32051U1

Majitel: SEMIX PLUSO spol. s.r.o., Otice, Agrotest fyto s.r.o., Kroměříž

Původce: ing. Kamil Lisal, Opava, Předměstí, Ing. Kateřina Vaculová, CSc.

Zástupce: Patentová kancelář VYNALEZY.cz, Mgr. Hana Jirkalová, Praha


Primery pro detekci Drechslera tritici-repentis v pšenici

Řešení se týká nových primerů pro detekci houbového patogena DTR v pletivech pšenice, což má význam v rostlinolékařství a molekulární biologii.

Zapsáno: 29.6.2011

Číslo dokumentu: CZ 22600U1

Majitel: Centrum výskumu rastlinnej výroby Piešťany, Piešťany - SK, Agrotest fyto, s. r. o., Kroměříž - CZ

Původce: Jozef Gubiš Ing. Ph.D., Bzince pod Javorinou - SK, Martina Hudcovicová Mgr. Ph.D., Vaďovce - SK, Marcela Gubišová Mgr., Bzince pod Javorinou - SK, Alžběta Žofajová Ing. Ph.D., Piešťany - SK, Michaela Havrlentová RNDr. Ph.D., Krakovany - SK, Martin Pastirčák Mgr. Ph.D., Nitra, SK, Daniel Mihálik Mgr. Ph.D., Čachtice, SK, Katarína Bojnanská Ing., Piešťany, SK, Ján Kraic Doc. RNDr. Ph.D., Piešťany, SK, Pavel Matušinsky Mgr. Ph.D., Kroměříž, CZ, Ludvík Tvarůžek Dr. Ing., Kroměříž, CZ

Zástupce: Ministerstvo Zemědělství ČR, Těšnov 17, Praha 1


Sonda a primery pro kvantifikaci patogena Ramularia collo-cygni v pletivech ječmene

Řešení se týká nových primerů pro detekci houbového patogena R. collo cygni v pletivech ječmene, což má význam v rostlinolékařství a molekulární biologii.

Zapsáno: 30.3.2010

Číslo dokumentu: CZ 20883 U1

Majitel: Centrum výskumu rastlinnej výroby Piešťany, Piešťany - SK, Výzkumný ústav rostlinné výroby, v. v. i., Praha- CZ, Agrotest fyto, s. r. o., Kroměříž - CZ

Původce: Josef Gubiš Ing. Ph.D., Bzince pod Javorinou - SK, Martina Hudcovicová Mgr. Ph.D., Vaďovce - SK, Leona Svobodová-Leišová RNDr. Ph.D., Praha - CZ, Pavel Matušinsky Mgr. Ph.D., Kroměříž - CZ

Zástupce: Ministerstvo Zemědělství ČR, Těšnov 17, Praha


Primery pro detekci Cochliobolus sativus v obilovinách

Řešení se týká nových primerů pro detekci houbového patogena Cochliobolus sativus v obilovinách, zejména v ječmeni a pšenici,
což má význam v rostlinolékařství a molekulární biologii.

Zapsáno: 25.08.2008

Číslo dokumentu: CZ 18831 U1

Majitel: Agrotest Fyto, s.r.o., Kroměříž

Původce: Mgr. Pavel Matušinský, PhD., Ing. Renata Mikolášová, PhD., Ing. Karel Klem, PhD., RNDr. Tomáš Spitzer PhD., Dr. Ing. Ludvík Tvarůžek

Zástupce: Ministerstvo Zemědělství ČR, Těšnov 17, Praha 1


Potraviny s bezpluchým ovsem

Řešení se týká nových různorodých potravin, které obsahují větší množství bezpluchého ovsa (Avena nuda L.)

Zapsáno: 06.11.2006

Číslo dokumentu:  CZ 16 972 U1

Majitel:  Výzkumný ústav potravinářský Praha, Agrotest Fyto, s.r.o., Kroměříž

Původce: Gabrovská Dana, Ing. Praha, Rysová Jana, Ing. Praha, Vaculová Kateřina, Ing., Kroměříž, Ouhrabková Jarmila, Ing.,Ing. Praha, Milotová Jarmila Ing., Dr., Kroměříž, Nedomová Lenka, Ing. Morkovice

Zástupce: Mgr. Hana Jirkalová, Těšnov 17, Praha 1, 11705


Potravina s bezpluchým ječmenem

Řešení se týká nových různorodých potravin, které obsahují větší množství bezpluchého ječmene

Zapsáno: 12.12.2005

Číslo dokumentu: CZ 16 072 U1

Majitel: Výzkumný ústav potravinářský Praha, Zemědělský výzkumný ústav Kroměříž, s.r.o.

Původce: Gabrovská Dana, Ing. Praha, Rysová Jana, Ing. Praha, Vaculová Kateřina, Ing., Kroměříž, Ouhrabková Jarmila, Ing., Ing. Praha

Zástupce: Mgr. Hana Jirkalová, Těšnov 17, Praha 1, 11705